What is the sequence of the complementary strand of DNA?
What is the sequence of the complementary strand of DNA?
Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded structure by matching base pairs. For example, the complementary sequence to C-A-T-G (where each letter stands for one of the bases in DNA) is G-T-A-C.
What will be the sequence of complementary strand of DNA has the sequence of Tatgactg?
A always pairs with T with two hydrogen bonds and G always pairs with C with three hydrogen bonds. So if one strand is ATGCTTGA then the complementary strand will be TACGAACT.
What is the sequence of the opposite strand of DNA?
The opposite strand (that is, the strand with a base sequence directly corresponding to the mRNA sequence) is called the coding strand or the mRNA-like strand because the sequence corresponds to the codons that are translated into protein.
What is the complementary strand of another DNA sequence if one strand of DNA has the sequence of Attgtcc?
Cytosine is complementary to guanine, and adenine is complementary to thymine. Thus, C pairs with G, G pairs with C, T pairs with A, and A pairs with T. So if a strand of DNA has the sequence ATTGTCC, then the complementary strand will have the sequence TAACAGG.
What is the complementary DNA strand of the following sequence Atgc?
TACG
The complementary DNA strand of the sequence ATGC will be TACG.
What is the sequence of the complementary strand of DNA from the 5 to the 3 direction?
According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3′- TACGTACGTACGTACGTACGTACGTACG − 5′. So, the sequence of the complimentary strand in 5′ to 3′ direction is 5′- GCATGCATGCATGCATGCATGCATGCAT− 3′.
What will be the complementary sequence of Atgc Atgc A?
The complementary DNA strand of the sequence ATGC will be TACG.
How does the sequence of one side of DNA determine the other side?
A always pairs with T (or in RNA, it pairs with U) G always pairs with C. So if you know the sequence of bases on one side of the ‘ladder,’ you can automatically determine the sequence of bases on the other side. The strands are therefore complementary to each other. Each side of the ladder is called a strand.
What must be broken for the DNA strand to separate?
hydrogen bonds connecting base pairs
In order for the DNA strands to separate, the hydrogen bonds connecting base pairs must be broken.
How do you find the sequence of DNA?
How to: Find transcript sequences for a gene
- Search the Gene database with the gene name, symbol.
- Click on the desired gene.
- Click on Reference Sequences in the Table of Contents at the upper right of the gene record.
When does one strand of DNA have the sequence atgcttga?
If one strand of DNA has the sequence ATGCTTGA, the sequence in the complementary strand would be: The base pairs on one strand of the DNA bind with the base pairs of the other strand specifically. A always pairs with T with two hydrogen bonds and G always pairs with C with three hydrogen bonds.
What would be the complementary RNA strand sequence?
If one strand of DNA has the nitrogenous base sequence as ATCTG, what would be the complementary RNA strand sequence? Pairing in strands follows the pairing principle. That is A with U and C with G. The given sequence on DNA strand is as follows: ATCTG. thus, the complementary one on RNA will be: UAGAC.
What is the sequence of a strand of DNA?
A strand of DNA has the following sequence: 5′ – TACGTTACG – 3′. What is the mRNA complement that will he generated from this DNA template through transcription?
What is the sequence of the nitrogenous base sequence in DNA?
Pairing in strands follows the pairing principle. That is A with U and C with G. The given sequence on DNA strand is as follows: ATCTG. thus, the complementary one on RNA will be: UAGAC. Was this answer helpful?